plasmid plko 1 puro scramble (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
plasmid plko 1 puro scramble
Plasmid Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1566 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko%2E1+scramble/pLKO%2E1+puro+(Plasmid+%238453)/pmc12978252-240-25-27
Average 96 stars, based on 1566 article reviews
Plasmid Plko 1 Puro Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1566 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plko%2E1+scramble/pLKO%2E1+puro+(Plasmid+%238453)/pmc12978252-240-25-27
Average 96 stars, based on 1566 article reviews
plasmid plko 1 puro scramble - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer. Article Snippet: The HCC1806 (ATCC CRL- 2335), HCC38 (ATCC CRL- 2314), and ZR- 75- 1 (ATCC CRL- 1500) human breast cancer cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 U/ ml), streptomycin (100 μg/ml), and amphotericin B (1 μg/ml). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer Article Snippet: The shRNAs shRBMS3-1 (TRCN0000152525) and shRBMS3-2 (TRCN0000152012) were cloned into plasmid pLKO.1-Puro (Addgene, #8453). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC. Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The Negative Control:Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer. Article Snippet: The HCC1806 (ATCC CRL- 2335), HCC38 (ATCC CRL- 2314), and ZR- 75- 1 (ATCC CRL- 1500) human breast cancer cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 U/ ml), streptomycin (100 μg/ml), and amphotericin B (1 μg/ml). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer Article Snippet: The shRNAs shRBMS3-1 (TRCN0000152525) and shRBMS3-2 (TRCN0000152012) were cloned into plasmid pLKO.1-Puro (Addgene, #8453). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC. Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The shRNA:Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer. Article Snippet: The HCC1806 (ATCC CRL- 2335), HCC38 (ATCC CRL- 2314), and ZR- 75- 1 (ATCC CRL- 1500) human breast cancer cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 U/ ml), streptomycin (100 μg/ml), and amphotericin B (1 μg/ml). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: Endogenous retroviral elements LTR8B and MER65 regulate the PSG9 locus that promotes trophoblast syncytialization: Insights into placental evolution and pre-eclampsia pathology Article Snippet: .. The Article Title: Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancer Article Snippet: The shRNAs shRBMS3-1 (TRCN0000152525) and shRBMS3-2 (TRCN0000152012) were cloned into plasmid pLKO.1-Puro (Addgene, #8453). .. Three shRNA pLKO.1 plasmids each against RBM4B (TRCN0000158566, TRCN0000159492, and TRCN0000159895) and SAMDA4B (TRCN0000433715, TRCN0000412300, and TRCN0000005449) were purchased ready made from Millipore with the Article Title: ΔNp63α drives serine synthesis to promote carboplatin resistance in NSCLC. Article Snippet: The short hairpin RNAs (shRNAs) targeting human p63 or ATF4 was generated by inserting specific oligoes into a pLKO.1-puromycin lentiviral vector (10878, Addgene, Cambridge, MA, USA). .. The Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The other:Article Title: A neuron subtype-specific role of MEK-ERK signaling in axon survival via transcriptional regulation of Nmnat2. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides PCR primers This study See Table S1 qPCR Nmnat2 forward primer: ATGACACCTGTGATCGGACA This study N/A qPCR Nmnat2 reverse primer: GAGGCTTTCTCCCACCTTTC This study N/A qPCR Gapdh forward primer: GTGTTCCTACCCCCAATGTG This study N/A qPCR Gapdh reverse primer: CCTGCTTCACCACCTTCTTG This study N/A Recombinant DNA Plasmid: |